Review



c3ar rabbit  (Biorbyt)


Bioz Verified Symbol Biorbyt is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Biorbyt c3ar rabbit
    C3ar Rabbit, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/C3AR+antibody/pmc12180114__JNC-169-0-s001-1-11-17
    Average 93 stars, based on 1 article reviews
    c3ar rabbit - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Western Blot:

    Article Title: Complement C3a and C5a Receptors Are Presented in Mouse Sciatic and Human Sural Nerves and Selectively Modulate the Neuronal Function of Large‐Caliber Fibers in Mice
    Article Snippet: .. Supplementary Table 1: Antibody Details Antigen Origin Dilution Manufacturer Catalog # C3aR Rabbit 1:200 (IF) 1:500 (WB) Biorbyt orb101135 C3aR Blocking Peptide 1:10 Biorbyt orb1476702 C5aR1 Rabbit 1:200 (IF) 1:500 (WB) Biorbyt orb393229 C5aR1 Blocking Peptide 1:10 Biorbyt orb39931 Caspr Mouse 1:100 Generously provided by Prof. Elior Peles, Weizmann Institute of Science Mab#275 M7-259 Peripherin Mouse 1:200 Novus NB300-138 NCAM Mouse 1:100 BDbiosciences BD559043 TNF-α Rabbit 1:500 GeneTex GTX110520 pERK Mouse 1:5000 Sigma-Aldrich M8159 Actin Mouse 1:1000 Sigma-Aldrich MAB1501 Secondary Antibodies Origin Dilution Manufacturer Catalog # Alexa Fluor® 488 AffiniPureTM anti mouse IgG1 Donkey 1:400 Jackson 115- 545-205 Alexa Fluor® 594 AffiniPureTM anti-rabbit Donkey 1:400 Jackson 711-585-152 Peroxidase AffiniPure® Goat Anti-Rabbit IgG Goat 1:10,000 Jackson 111-035-144 Peroxidase AffiniPure® Goat Anti-Mouse IgG Goat 1:10,000 Jackson 115-035-146 C3aR- complement receptor C3a; C5aR1- complement receptor C5a; Caspr- contactin-associated protein; NCAM- neural cell adhesion molecule; TNF-α- tumor necrosis factor α; pERK- phosphorylated ERK Supplementary Table 2: Primers Gene Forward Reverse HPRT GATTAGCGATGATGAACCAGGTT CCTCCCATCTCCTTCATGACA C3 AGAAGCGTCTCCATCAAGATTCC ACCACTGTCACGTACTTGTGC C3aR TCGATGCTGACACCAATTCAA TCCCAATAGACAAGTGAGACCAA C5 CCTGTTACCAGTGATGAAGGCAG TCGTTAGTGAGTCAGGCAGCGT C5aR1 CATACCTGCGGATGGCATTCA GGAACACCACCGAGTAGATGAT HPRT- Hypoxanthine guanine phosphoribosyltransferase; C3aR- complement receptor C3a; C5aR1- complement receptor C5a Electrophysiology The three-compartment chamber was meticulously crafted per spec using Akulon®, a highperformance polyamide 6 and polyamide 66 material. ..

    Blocking Assay:

    Article Title: Complement C3a and C5a Receptors Are Presented in Mouse Sciatic and Human Sural Nerves and Selectively Modulate the Neuronal Function of Large‐Caliber Fibers in Mice
    Article Snippet: .. Supplementary Table 1: Antibody Details Antigen Origin Dilution Manufacturer Catalog # C3aR Rabbit 1:200 (IF) 1:500 (WB) Biorbyt orb101135 C3aR Blocking Peptide 1:10 Biorbyt orb1476702 C5aR1 Rabbit 1:200 (IF) 1:500 (WB) Biorbyt orb393229 C5aR1 Blocking Peptide 1:10 Biorbyt orb39931 Caspr Mouse 1:100 Generously provided by Prof. Elior Peles, Weizmann Institute of Science Mab#275 M7-259 Peripherin Mouse 1:200 Novus NB300-138 NCAM Mouse 1:100 BDbiosciences BD559043 TNF-α Rabbit 1:500 GeneTex GTX110520 pERK Mouse 1:5000 Sigma-Aldrich M8159 Actin Mouse 1:1000 Sigma-Aldrich MAB1501 Secondary Antibodies Origin Dilution Manufacturer Catalog # Alexa Fluor® 488 AffiniPureTM anti mouse IgG1 Donkey 1:400 Jackson 115- 545-205 Alexa Fluor® 594 AffiniPureTM anti-rabbit Donkey 1:400 Jackson 711-585-152 Peroxidase AffiniPure® Goat Anti-Rabbit IgG Goat 1:10,000 Jackson 111-035-144 Peroxidase AffiniPure® Goat Anti-Mouse IgG Goat 1:10,000 Jackson 115-035-146 C3aR- complement receptor C3a; C5aR1- complement receptor C5a; Caspr- contactin-associated protein; NCAM- neural cell adhesion molecule; TNF-α- tumor necrosis factor α; pERK- phosphorylated ERK Supplementary Table 2: Primers Gene Forward Reverse HPRT GATTAGCGATGATGAACCAGGTT CCTCCCATCTCCTTCATGACA C3 AGAAGCGTCTCCATCAAGATTCC ACCACTGTCACGTACTTGTGC C3aR TCGATGCTGACACCAATTCAA TCCCAATAGACAAGTGAGACCAA C5 CCTGTTACCAGTGATGAAGGCAG TCGTTAGTGAGTCAGGCAGCGT C5aR1 CATACCTGCGGATGGCATTCA GGAACACCACCGAGTAGATGAT HPRT- Hypoxanthine guanine phosphoribosyltransferase; C3aR- complement receptor C3a; C5aR1- complement receptor C5a Electrophysiology The three-compartment chamber was meticulously crafted per spec using Akulon®, a highperformance polyamide 6 and polyamide 66 material. ..



    Similar Products

    93
    Biorbyt c3ar rabbit
    C3ar Rabbit, supplied by Biorbyt, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/C3AR+antibody/pmc12180114__JNC-169-0-s001-1-11-17
    Average 93 stars, based on 1 article reviews
    c3ar rabbit - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    OriGene chicken anti c3ar
    Chicken Anti C3ar, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/C3AR1+Rabbit+Polyclonal+Antibody/pm40425792-699-136-141
    Average 93 stars, based on 1 article reviews
    chicken anti c3ar - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    94
    Santa Cruz Biotechnology rabbit anti c3ar
    Rabbit Anti C3ar, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/mouse+anti-rabbit+IgG-R/bio_rxiv__2025__01__16__633468-46-18-22
    Average 94 stars, based on 1 article reviews
    rabbit anti c3ar - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    90
    ABclonal Biotechnology rabbit anti-c3ar antibody
    Rabbit Anti C3ar Antibody, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/rabbit+anti+c3ar+antibody/pmc11725764-99-101-105
    Average 90 stars, based on 1 article reviews
    rabbit anti-c3ar antibody - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    86
    Danaher Inc duolink antibody diluent rabbit anti c3ar
    C3a-peptide increases the percentage of oocytes at the MII stage by directly interacting with <t>C3aR.</t> A Confirming the direct interaction between C3a-peptide and C3aR by Co-IP. B RT-PCR results show the C3AR1 mRNA expression levels of mouse oocytes at different stages (three independent biological replicates). C Double immunofluorescences staining reveals that C3aR and β-tubulin co-localized in the cytoplasm at the GV and GVBD stages and co-localized to spindles at the MI and MII stages (three independent biological replicates). D Morphological changes of mouse oocytes during maturation in response to C3a-peptides combined with C3aR antagonist treatment at different concentrations. E Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the MII stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). F Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the GVBD stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells
    Duolink Antibody Diluent Rabbit Anti C3ar, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/pmc10709936-422-21-29
    Average 86 stars, based on 1 article reviews
    duolink antibody diluent rabbit anti c3ar - by Bioz Stars, 2026-10
    86/100 stars
      Buy from Supplier

    90
    Santa Cruz Biotechnology rabbit anti-c3ar or anti-c5ar1 polyclonal antibody (pab
    C3a-peptide increases the percentage of oocytes at the MII stage by directly interacting with <t>C3aR.</t> A Confirming the direct interaction between C3a-peptide and C3aR by Co-IP. B RT-PCR results show the C3AR1 mRNA expression levels of mouse oocytes at different stages (three independent biological replicates). C Double immunofluorescences staining reveals that C3aR and β-tubulin co-localized in the cytoplasm at the GV and GVBD stages and co-localized to spindles at the MI and MII stages (three independent biological replicates). D Morphological changes of mouse oocytes during maturation in response to C3a-peptides combined with C3aR antagonist treatment at different concentrations. E Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the MII stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). F Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the GVBD stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells
    Rabbit Anti C3ar Or Anti C5ar1 Polyclonal Antibody (Pab, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/c3ar+antibody/pmc08604193-76-22-29
    Average 90 stars, based on 1 article reviews
    rabbit anti-c3ar or anti-c5ar1 polyclonal antibody (pab - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Absolute Biotech Inc rabbit anti-c3ar antibody
    Glomerular and tubular C3 and <t>C3aR</t> staining in Stx2/LPS mice: ( A ) Representative images and quantification of intraglomerular and tubular C3 staining (green) in control and Stx2/LPS-injected mice at 48 h; ( B ) Representative images and quantification of intraglomerular and tubular C3aR expression (red) in control and Stx2/LPS-injected mice. Scale bars: 20 μm. Results are presented as mean ± SEM (control n = 4, Stx2/LPS n = 7), and unpaired Student’s t test was used. * p < 0.05, ** p < 0.01.
    Rabbit Anti C3ar Antibody, supplied by Absolute Biotech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/rabbit+anti+c3ar+antibody/pmc09179250-36-8-13
    Average 90 stars, based on 1 article reviews
    rabbit anti-c3ar antibody - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    Absolute Biotech Inc rabbit anti-c3ar
    Glomerular and tubular C3 and <t>C3aR</t> staining in Stx2/LPS mice: ( A ) Representative images and quantification of intraglomerular and tubular C3 staining (green) in control and Stx2/LPS-injected mice at 48 h; ( B ) Representative images and quantification of intraglomerular and tubular C3aR expression (red) in control and Stx2/LPS-injected mice. Scale bars: 20 μm. Results are presented as mean ± SEM (control n = 4, Stx2/LPS n = 7), and unpaired Student’s t test was used. * p < 0.05, ** p < 0.01.
    Rabbit Anti C3ar, supplied by Absolute Biotech Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/rabbit+anti+c3ar+antibody/pmc09179250-74-5-9
    Average 90 stars, based on 1 article reviews
    rabbit anti-c3ar - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    90
    AtaGenix Inc rabbit anti-grass carp c3ar pabs
    Detection of the specificity of the rabbit <t>anti-C3aR</t> <t>pAbs.</t> (A–D) Blocking of the anti-C3aR pAbs by preincubation with the antigenic peptide used for pAb development. (A) Gating strategy for flow cytometry analysis of HKLs stained with rabbit anti-C3aR pAbs. The lymphocytes (Lym) were gated to further analyze the C3aR positive cells. (B) Lym in HKLs stained with rabbit IgG isotype control Abs. (C) Lym in HKLs stained with rabbit anti-C3aR pAbs. (D) Lym in HKLs stained with peptide-preincubated rabbit anti-C3aR pAbs. The rabbit anti-C3aR pAbs were preincubated with the peptide at different molar ratios for 30 min, then stained HKLs for flow cytometry. (E, F) Expression of C3aR in C3aR + Lym and C3aR - Lym. (E) Sorting of C3aR + Lym and C3aR - Lym by FACS. HKLs were stained with rabbit anti-C3aR pAbs, then C3aR + Lym and C3aR - Lym were sorted and subjected to RNA isolation and cDNA synthesis. (F) The mRNA expression level of C3aR in C3aR + Lym and C3aR - Lym. The mRNA expression level of C3aR in C3aR + Lym and C3aR - Lym was analyzed by qPCR and normalized against the expression of β-actin using the 2 −ΔCt method. One representative result was shown in (A–E) . Data in (F) are presented as mean ± SEM (n = 5 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (** p < 0.01).
    Rabbit Anti Grass Carp C3ar Pabs, supplied by AtaGenix Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c3ar+rabbit/rabbit+anti+grass+carp+c3ar+pabs/pmc08977587-86-1-11
    Average 90 stars, based on 1 article reviews
    rabbit anti-grass carp c3ar pabs - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    C3a-peptide increases the percentage of oocytes at the MII stage by directly interacting with C3aR. A Confirming the direct interaction between C3a-peptide and C3aR by Co-IP. B RT-PCR results show the C3AR1 mRNA expression levels of mouse oocytes at different stages (three independent biological replicates). C Double immunofluorescences staining reveals that C3aR and β-tubulin co-localized in the cytoplasm at the GV and GVBD stages and co-localized to spindles at the MI and MII stages (three independent biological replicates). D Morphological changes of mouse oocytes during maturation in response to C3a-peptides combined with C3aR antagonist treatment at different concentrations. E Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the MII stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). F Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the GVBD stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells

    Journal: BMC Biology

    Article Title: Follicular fluid C3a-peptide promotes oocyte maturation through F-actin aggregation

    doi: 10.1186/s12915-023-01760-6

    Figure Lengend Snippet: C3a-peptide increases the percentage of oocytes at the MII stage by directly interacting with C3aR. A Confirming the direct interaction between C3a-peptide and C3aR by Co-IP. B RT-PCR results show the C3AR1 mRNA expression levels of mouse oocytes at different stages (three independent biological replicates). C Double immunofluorescences staining reveals that C3aR and β-tubulin co-localized in the cytoplasm at the GV and GVBD stages and co-localized to spindles at the MI and MII stages (three independent biological replicates). D Morphological changes of mouse oocytes during maturation in response to C3a-peptides combined with C3aR antagonist treatment at different concentrations. E Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the MII stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). F Calculation and statistical analysis of the percentage of cultured mouse oocytes entering the GVBD stage in response to C3a-peptide combined with C3aR antagonist treatment at different concentrations (five independent biological replicates). Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells

    Article Snippet: After fixation and permeabilization, oocytes were incubated in blocking solution and immunolabeled (overnight, 4 °C) with primary antibodies diluted in the DuoLink® antibody diluent: rabbit anti-C3AR and anti-MYO10 (ab58699, Abcam); negative controls excluded one primary antibody or both.

    Techniques: Co-Immunoprecipitation Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Staining, Cell Culture

    C3aR promotes oocyte maturation by enabling F-actin aggregation and spindle migration. A Diagram depicting C3aR morpholino delivery into oocytes. B Western blotting shows the validation of the inhibitory efficiency of the C3aR morpholino (two independent biological replicates). C Morphological changes of mouse oocytes during maturation in response to C3aR morpholino injection. D C3aR morpholinos significantly reduce the percentage of oocytes entering the GVBD stage (five independent biological replicates). E C3aR morpholinos significantly reduce the percentage of oocytes entering the MII stage (five independent biological replicates). F Triple immunofluorescence staining shows that C3aR morpholino injection suppressed C3aR expression (red) and inhibited F-actin aggregation in the sub-cortical and spindle regions (pink) (three independent biological replicates). G Diagram of six quantitative indexes: ( a ) ratio of the spindle width to oocyte diameter (W/D); ( b ) ratio of the spindle inter-polar distance to oocyte diameter (L/D); (c) length from the spindle to the cortex (S-C); ( d ) relative intensity of F-actin in the subcortical region (S1); ( e ) relative intensity of F-actin around the spindle (S2); ( f ) cortical thickness. H W/D was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. I L/D was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. J S-C was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. K S1 was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. L S2 was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. M Cortical thickness was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells

    Journal: BMC Biology

    Article Title: Follicular fluid C3a-peptide promotes oocyte maturation through F-actin aggregation

    doi: 10.1186/s12915-023-01760-6

    Figure Lengend Snippet: C3aR promotes oocyte maturation by enabling F-actin aggregation and spindle migration. A Diagram depicting C3aR morpholino delivery into oocytes. B Western blotting shows the validation of the inhibitory efficiency of the C3aR morpholino (two independent biological replicates). C Morphological changes of mouse oocytes during maturation in response to C3aR morpholino injection. D C3aR morpholinos significantly reduce the percentage of oocytes entering the GVBD stage (five independent biological replicates). E C3aR morpholinos significantly reduce the percentage of oocytes entering the MII stage (five independent biological replicates). F Triple immunofluorescence staining shows that C3aR morpholino injection suppressed C3aR expression (red) and inhibited F-actin aggregation in the sub-cortical and spindle regions (pink) (three independent biological replicates). G Diagram of six quantitative indexes: ( a ) ratio of the spindle width to oocyte diameter (W/D); ( b ) ratio of the spindle inter-polar distance to oocyte diameter (L/D); (c) length from the spindle to the cortex (S-C); ( d ) relative intensity of F-actin in the subcortical region (S1); ( e ) relative intensity of F-actin around the spindle (S2); ( f ) cortical thickness. H W/D was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. I L/D was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. J S-C was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. K S1 was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. L S2 was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. M Cortical thickness was analyzed and compared between the negative control and C3aR morpholino-injected oocytes. Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells

    Article Snippet: After fixation and permeabilization, oocytes were incubated in blocking solution and immunolabeled (overnight, 4 °C) with primary antibodies diluted in the DuoLink® antibody diluent: rabbit anti-C3AR and anti-MYO10 (ab58699, Abcam); negative controls excluded one primary antibody or both.

    Techniques: Migration, Western Blot, Injection, Immunofluorescence, Staining, Expressing, Negative Control

    C3a-peptide combined with C3aR promotes F-actin aggregation and spindle dynamics by directly binding to MYO10. A Triple immunofluorescence staining shows that C3a-peptide treatment increased C3aR expression (green) and enhanced F-actin aggregation in the cytoplasm, sub-cortical regions, and around the spindle (pink). C3aR and tubulin co-localized to the spindle (three independent biological replicates). B F-actin probes in living cells revealed that C3a-peptide treatment enhanced F-actin aggregation in the sub-cortical regions and around the spindle. C W/D, L/D, S-C, S1, S2, and cortical thickness were calculated and compared between the untreated and C3a-peptide-treated groups. D Triple immunofluorescence staining showed that the enhanced F-actin positive signals in the cytoplasm, sub-cortical regions, and around the spindle (pink) caused by C3a-peptide treatment were restored with a C3aR morpholino injection (three independent biological replicates). E Direct interaction between C3aR and MYO10 in mouse oocytes was determined with a proximity ligation assay (PLA) using rabbit anti-C3aR and anti-MYO10 antibodies. After staining, the oocytes were imaged by confocal and differential interference contrast (DIC) microscopy. Scale bar, 20 μm. F W/D, L/D, S-C, S1, S2, and cortical thickness were calculated and compared between the C3a-peptide-treated group and the combined C3a-peptide-treated and C3aR morpholino-injected group. G Confirming the direct interaction between C3aR and MYO10 by Co-IP (three independent biological replicates). Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells

    Journal: BMC Biology

    Article Title: Follicular fluid C3a-peptide promotes oocyte maturation through F-actin aggregation

    doi: 10.1186/s12915-023-01760-6

    Figure Lengend Snippet: C3a-peptide combined with C3aR promotes F-actin aggregation and spindle dynamics by directly binding to MYO10. A Triple immunofluorescence staining shows that C3a-peptide treatment increased C3aR expression (green) and enhanced F-actin aggregation in the cytoplasm, sub-cortical regions, and around the spindle (pink). C3aR and tubulin co-localized to the spindle (three independent biological replicates). B F-actin probes in living cells revealed that C3a-peptide treatment enhanced F-actin aggregation in the sub-cortical regions and around the spindle. C W/D, L/D, S-C, S1, S2, and cortical thickness were calculated and compared between the untreated and C3a-peptide-treated groups. D Triple immunofluorescence staining showed that the enhanced F-actin positive signals in the cytoplasm, sub-cortical regions, and around the spindle (pink) caused by C3a-peptide treatment were restored with a C3aR morpholino injection (three independent biological replicates). E Direct interaction between C3aR and MYO10 in mouse oocytes was determined with a proximity ligation assay (PLA) using rabbit anti-C3aR and anti-MYO10 antibodies. After staining, the oocytes were imaged by confocal and differential interference contrast (DIC) microscopy. Scale bar, 20 μm. F W/D, L/D, S-C, S1, S2, and cortical thickness were calculated and compared between the C3a-peptide-treated group and the combined C3a-peptide-treated and C3aR morpholino-injected group. G Confirming the direct interaction between C3aR and MYO10 by Co-IP (three independent biological replicates). Data are presented as the means ± SD. * P < 0.05, ** P < 0.01, and *** P < 0.001 as compared to control cells

    Article Snippet: After fixation and permeabilization, oocytes were incubated in blocking solution and immunolabeled (overnight, 4 °C) with primary antibodies diluted in the DuoLink® antibody diluent: rabbit anti-C3AR and anti-MYO10 (ab58699, Abcam); negative controls excluded one primary antibody or both.

    Techniques: Binding Assay, Immunofluorescence, Staining, Expressing, Injection, Proximity Ligation Assay, Microscopy, Co-Immunoprecipitation Assay

    Sketches illustrating the molecular mechanisms of C3a-peptide and C3aR action during meiotic division of oocytes. C3a-peptide accumulates in the follicular fluid during the follicular maturation process and then enters the cytoplasm of the oocytes, where it exerts its effects on maturation by binding to C3aR. C3aR and β-tubulin co-localize on the spindles and directly interact with an intermediate molecule, MYO10. MYO10 contains two domains, the head motor and MyTH4-FERM domain, which bind to F-actin and microtubules, respectively. Our result revealed that C3aR can bind to MYO10. Thus, these molecules collaborate to participate in F-actin aggregation and spindle dynamics in meiotic oocytes

    Journal: BMC Biology

    Article Title: Follicular fluid C3a-peptide promotes oocyte maturation through F-actin aggregation

    doi: 10.1186/s12915-023-01760-6

    Figure Lengend Snippet: Sketches illustrating the molecular mechanisms of C3a-peptide and C3aR action during meiotic division of oocytes. C3a-peptide accumulates in the follicular fluid during the follicular maturation process and then enters the cytoplasm of the oocytes, where it exerts its effects on maturation by binding to C3aR. C3aR and β-tubulin co-localize on the spindles and directly interact with an intermediate molecule, MYO10. MYO10 contains two domains, the head motor and MyTH4-FERM domain, which bind to F-actin and microtubules, respectively. Our result revealed that C3aR can bind to MYO10. Thus, these molecules collaborate to participate in F-actin aggregation and spindle dynamics in meiotic oocytes

    Article Snippet: After fixation and permeabilization, oocytes were incubated in blocking solution and immunolabeled (overnight, 4 °C) with primary antibodies diluted in the DuoLink® antibody diluent: rabbit anti-C3AR and anti-MYO10 (ab58699, Abcam); negative controls excluded one primary antibody or both.

    Techniques: Binding Assay

    Glomerular and tubular C3 and C3aR staining in Stx2/LPS mice: ( A ) Representative images and quantification of intraglomerular and tubular C3 staining (green) in control and Stx2/LPS-injected mice at 48 h; ( B ) Representative images and quantification of intraglomerular and tubular C3aR expression (red) in control and Stx2/LPS-injected mice. Scale bars: 20 μm. Results are presented as mean ± SEM (control n = 4, Stx2/LPS n = 7), and unpaired Student’s t test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Glomerular and tubular C3 and C3aR staining in Stx2/LPS mice: ( A ) Representative images and quantification of intraglomerular and tubular C3 staining (green) in control and Stx2/LPS-injected mice at 48 h; ( B ) Representative images and quantification of intraglomerular and tubular C3aR expression (red) in control and Stx2/LPS-injected mice. Scale bars: 20 μm. Results are presented as mean ± SEM (control n = 4, Stx2/LPS n = 7), and unpaired Student’s t test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: For C3aR expression, double staining was performed with rabbit anti-C3aR antibody (1:100; LS-C382362, Lifespan BioSciences, Seattle, WA, USA) and Cy3-conjugated secondary antibody (1:100; 111-165-003, Jackson Immunoresearch Laboratories, West Grove, PA, USA), followed by rat anti-nestin (1:300; ab81462, Abcam, Cambridge, UK) and the appropriate FITC-conjugated secondary antibody (Jackson Immunoresearch Laboratories).

    Techniques: Staining, Injection, Expressing

    Treatment with the C3aR antagonist limits glomerular mitochondrial alterations in Stx2/LPS mice: ( A ) Representative transmission electron microscope images showing mitochondrial morphology in podocytes of control and Stx2/LPS mice, given vehicle or C3aR antagonist (C3aRa). Scale bars: 500 nm; ( B ) Quantification of mitochondrial length and area and ( C ) characterization of mitochondrial subpopulations in podocytes. Results are expressed as mean ± SEM (control: n = 516 mitochondria analyzed in n = 6 glomeruli of n = 2 mice; Stx2/LPS + vehicle: n = 411 mitochondria analyzed in n = 7 glomeruli of n = 3 mice; Stx2/LPS + C3aRa: n = 529 mitochondria analyzed in n = 7 glomeruli of n = 3 mice); ( D ) Representative images and quantification of glomerular VDAC (upper panels) and ATP5I (bottom panels) staining in controls and Stx2/LPS mice given vehicle or C3aRa. Podocytes are indicated by red arrowheads. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Treatment with the C3aR antagonist limits glomerular mitochondrial alterations in Stx2/LPS mice: ( A ) Representative transmission electron microscope images showing mitochondrial morphology in podocytes of control and Stx2/LPS mice, given vehicle or C3aR antagonist (C3aRa). Scale bars: 500 nm; ( B ) Quantification of mitochondrial length and area and ( C ) characterization of mitochondrial subpopulations in podocytes. Results are expressed as mean ± SEM (control: n = 516 mitochondria analyzed in n = 6 glomeruli of n = 2 mice; Stx2/LPS + vehicle: n = 411 mitochondria analyzed in n = 7 glomeruli of n = 3 mice; Stx2/LPS + C3aRa: n = 529 mitochondria analyzed in n = 7 glomeruli of n = 3 mice); ( D ) Representative images and quantification of glomerular VDAC (upper panels) and ATP5I (bottom panels) staining in controls and Stx2/LPS mice given vehicle or C3aRa. Podocytes are indicated by red arrowheads. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: For C3aR expression, double staining was performed with rabbit anti-C3aR antibody (1:100; LS-C382362, Lifespan BioSciences, Seattle, WA, USA) and Cy3-conjugated secondary antibody (1:100; 111-165-003, Jackson Immunoresearch Laboratories, West Grove, PA, USA), followed by rat anti-nestin (1:300; ab81462, Abcam, Cambridge, UK) and the appropriate FITC-conjugated secondary antibody (Jackson Immunoresearch Laboratories).

    Techniques: Transmission Assay, Microscopy, Staining

    The C3aR blockade reduced proximal tubular cell apoptosis and restored megalin expression in Stx2/LPS mice. ( A , B ) Representative images and quantification of ( A ) cleaved caspase-3 (red) and ( B ) megalin (red) in control and Stx2/LPS mice given vehicle or C3aRa. Arrowheads indicate loss of megalin expression on the proximal tubular cell brush border. Cell membranes and nuclei were stained with FITC-WGA-lectin (green) and DAPI (blue), respectively. Scale bars: 20 μm. Results are expressed as mean ± SEM ( n = 4 per each group), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: The C3aR blockade reduced proximal tubular cell apoptosis and restored megalin expression in Stx2/LPS mice. ( A , B ) Representative images and quantification of ( A ) cleaved caspase-3 (red) and ( B ) megalin (red) in control and Stx2/LPS mice given vehicle or C3aRa. Arrowheads indicate loss of megalin expression on the proximal tubular cell brush border. Cell membranes and nuclei were stained with FITC-WGA-lectin (green) and DAPI (blue), respectively. Scale bars: 20 μm. Results are expressed as mean ± SEM ( n = 4 per each group), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: For C3aR expression, double staining was performed with rabbit anti-C3aR antibody (1:100; LS-C382362, Lifespan BioSciences, Seattle, WA, USA) and Cy3-conjugated secondary antibody (1:100; 111-165-003, Jackson Immunoresearch Laboratories, West Grove, PA, USA), followed by rat anti-nestin (1:300; ab81462, Abcam, Cambridge, UK) and the appropriate FITC-conjugated secondary antibody (Jackson Immunoresearch Laboratories).

    Techniques: Expressing, Staining

    The C3aR blockade restores mitochondrial morphology and function in proximal tubular cells in Stx2/LPS mice. ( A , B ) Representative transmission electron microscope images and morphometric analysis showing mitochondrial morphology in proximal tubular cells of control and Stx2/LPS mice, given vehicle or C3aRa. Scale bars: 500 nm. Results are expressed as mean ± SEM (control: n = 6768 mitochondria analyzed in n = 3 mice; Stx2/LPS + vehicle: n = 4238 mitochondria analyzed in n = 3 mice; Stx2/LPS + C3aRa: n = 7100 mitochondria analyzed in n = 3 mice). ( C ) Representative images and quantification of tubular VDAC (upper panels) and ATP5I (bottom panels) stainings in control and Stx2/LPS mice with or without C3aRa. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7). ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: The C3aR blockade restores mitochondrial morphology and function in proximal tubular cells in Stx2/LPS mice. ( A , B ) Representative transmission electron microscope images and morphometric analysis showing mitochondrial morphology in proximal tubular cells of control and Stx2/LPS mice, given vehicle or C3aRa. Scale bars: 500 nm. Results are expressed as mean ± SEM (control: n = 6768 mitochondria analyzed in n = 3 mice; Stx2/LPS + vehicle: n = 4238 mitochondria analyzed in n = 3 mice; Stx2/LPS + C3aRa: n = 7100 mitochondria analyzed in n = 3 mice). ( C ) Representative images and quantification of tubular VDAC (upper panels) and ATP5I (bottom panels) stainings in control and Stx2/LPS mice with or without C3aRa. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7). ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: For C3aR expression, double staining was performed with rabbit anti-C3aR antibody (1:100; LS-C382362, Lifespan BioSciences, Seattle, WA, USA) and Cy3-conjugated secondary antibody (1:100; 111-165-003, Jackson Immunoresearch Laboratories, West Grove, PA, USA), followed by rat anti-nestin (1:300; ab81462, Abcam, Cambridge, UK) and the appropriate FITC-conjugated secondary antibody (Jackson Immunoresearch Laboratories).

    Techniques: Transmission Assay, Microscopy

    Treatment with the C3aR antagonist limits tubulin alterations in proximal tubules of Stx2/LPS mice. Representative images of tubulin expression (green) in control and Stx2/LPS mice receiving vehicle or C3aRa. Nuclei were stained with DAPI (blue). Scale bars: 20 μm.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Treatment with the C3aR antagonist limits tubulin alterations in proximal tubules of Stx2/LPS mice. Representative images of tubulin expression (green) in control and Stx2/LPS mice receiving vehicle or C3aRa. Nuclei were stained with DAPI (blue). Scale bars: 20 μm.

    Article Snippet: For C3aR expression, double staining was performed with rabbit anti-C3aR antibody (1:100; LS-C382362, Lifespan BioSciences, Seattle, WA, USA) and Cy3-conjugated secondary antibody (1:100; 111-165-003, Jackson Immunoresearch Laboratories, West Grove, PA, USA), followed by rat anti-nestin (1:300; ab81462, Abcam, Cambridge, UK) and the appropriate FITC-conjugated secondary antibody (Jackson Immunoresearch Laboratories).

    Techniques: Expressing, Staining

    Stx2 increases podocyte and tubular cell sensitivity to C3a through the upregulation of C3aR expression in vitro. ( A ) Representative images and quantification of C3aR staining (red) in podocytes and RPTECs exposed to control medium or Stx2 (50 pM) for 15 h. Nuclei were counterstained with DAPI (blue). Scale bars: 20 μm. Results are presented as mean ± SEM (number of biological samples: n = 3 control and Stx2-treated podocytes; n = 4 control RPTECs and n = 6 Stx2-treated RPTECs), and unpaired Student’s t test was used. ( B ) Representative images of mitochondria labeled with MitoTracker in live podocytes and RPTECs incubated with control medium, C3a (1 μM, 6 h) alone, or with Stx2 (50 pM, 24 h) in the presence of C3a, added in the last 6 h. Nuclei were counterstained with Hoechst (blue). Arrowhead indicates mitochondrial swelling. The percentage of cells with an altered mitochondrial pattern, in terms of fragmentation and perinuclear redistribution, on total cells per field was quantified. Scale bars: 20 μm. Results are expressed as mean ± SEM (number of biological samples: n = 3 control, C3a and Stx2 + C3a-treated podocytes and RPTECs), and ANOVA with Tukey multiple-comparisons test was used. ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Stx2 increases podocyte and tubular cell sensitivity to C3a through the upregulation of C3aR expression in vitro. ( A ) Representative images and quantification of C3aR staining (red) in podocytes and RPTECs exposed to control medium or Stx2 (50 pM) for 15 h. Nuclei were counterstained with DAPI (blue). Scale bars: 20 μm. Results are presented as mean ± SEM (number of biological samples: n = 3 control and Stx2-treated podocytes; n = 4 control RPTECs and n = 6 Stx2-treated RPTECs), and unpaired Student’s t test was used. ( B ) Representative images of mitochondria labeled with MitoTracker in live podocytes and RPTECs incubated with control medium, C3a (1 μM, 6 h) alone, or with Stx2 (50 pM, 24 h) in the presence of C3a, added in the last 6 h. Nuclei were counterstained with Hoechst (blue). Arrowhead indicates mitochondrial swelling. The percentage of cells with an altered mitochondrial pattern, in terms of fragmentation and perinuclear redistribution, on total cells per field was quantified. Scale bars: 20 μm. Results are expressed as mean ± SEM (number of biological samples: n = 3 control, C3a and Stx2 + C3a-treated podocytes and RPTECs), and ANOVA with Tukey multiple-comparisons test was used. ** p < 0.01.

    Article Snippet: For C3aR expression, double staining was performed with rabbit anti-C3aR antibody (1:100; LS-C382362, Lifespan BioSciences, Seattle, WA, USA) and Cy3-conjugated secondary antibody (1:100; 111-165-003, Jackson Immunoresearch Laboratories, West Grove, PA, USA), followed by rat anti-nestin (1:300; ab81462, Abcam, Cambridge, UK) and the appropriate FITC-conjugated secondary antibody (Jackson Immunoresearch Laboratories).

    Techniques: Expressing, In Vitro, Staining, Labeling, Incubation

    Glomerular and tubular C3 and C3aR staining in Stx2/LPS mice: ( A ) Representative images and quantification of intraglomerular and tubular C3 staining (green) in control and Stx2/LPS-injected mice at 48 h; ( B ) Representative images and quantification of intraglomerular and tubular C3aR expression (red) in control and Stx2/LPS-injected mice. Scale bars: 20 μm. Results are presented as mean ± SEM (control n = 4, Stx2/LPS n = 7), and unpaired Student’s t test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Glomerular and tubular C3 and C3aR staining in Stx2/LPS mice: ( A ) Representative images and quantification of intraglomerular and tubular C3 staining (green) in control and Stx2/LPS-injected mice at 48 h; ( B ) Representative images and quantification of intraglomerular and tubular C3aR expression (red) in control and Stx2/LPS-injected mice. Scale bars: 20 μm. Results are presented as mean ± SEM (control n = 4, Stx2/LPS n = 7), and unpaired Student’s t test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: Cells were incubated with a rabbit anti-C3aR (1:50; LS-C382362, Lifespan BioSciences, Seattle, DC, USA) antibody followed by a Cy3-conjugated secondary antibody (1:80; 711-165-152, Jackson ImmunoResearch Laboratories).

    Techniques: Staining, Injection, Expressing

    Treatment with the C3aR antagonist limits glomerular mitochondrial alterations in Stx2/LPS mice: ( A ) Representative transmission electron microscope images showing mitochondrial morphology in podocytes of control and Stx2/LPS mice, given vehicle or C3aR antagonist (C3aRa). Scale bars: 500 nm; ( B ) Quantification of mitochondrial length and area and ( C ) characterization of mitochondrial subpopulations in podocytes. Results are expressed as mean ± SEM (control: n = 516 mitochondria analyzed in n = 6 glomeruli of n = 2 mice; Stx2/LPS + vehicle: n = 411 mitochondria analyzed in n = 7 glomeruli of n = 3 mice; Stx2/LPS + C3aRa: n = 529 mitochondria analyzed in n = 7 glomeruli of n = 3 mice); ( D ) Representative images and quantification of glomerular VDAC (upper panels) and ATP5I (bottom panels) staining in controls and Stx2/LPS mice given vehicle or C3aRa. Podocytes are indicated by red arrowheads. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Treatment with the C3aR antagonist limits glomerular mitochondrial alterations in Stx2/LPS mice: ( A ) Representative transmission electron microscope images showing mitochondrial morphology in podocytes of control and Stx2/LPS mice, given vehicle or C3aR antagonist (C3aRa). Scale bars: 500 nm; ( B ) Quantification of mitochondrial length and area and ( C ) characterization of mitochondrial subpopulations in podocytes. Results are expressed as mean ± SEM (control: n = 516 mitochondria analyzed in n = 6 glomeruli of n = 2 mice; Stx2/LPS + vehicle: n = 411 mitochondria analyzed in n = 7 glomeruli of n = 3 mice; Stx2/LPS + C3aRa: n = 529 mitochondria analyzed in n = 7 glomeruli of n = 3 mice); ( D ) Representative images and quantification of glomerular VDAC (upper panels) and ATP5I (bottom panels) staining in controls and Stx2/LPS mice given vehicle or C3aRa. Podocytes are indicated by red arrowheads. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: Cells were incubated with a rabbit anti-C3aR (1:50; LS-C382362, Lifespan BioSciences, Seattle, DC, USA) antibody followed by a Cy3-conjugated secondary antibody (1:80; 711-165-152, Jackson ImmunoResearch Laboratories).

    Techniques: Transmission Assay, Microscopy, Staining

    The C3aR blockade reduced proximal tubular cell apoptosis and restored megalin expression in Stx2/LPS mice. ( A , B ) Representative images and quantification of ( A ) cleaved caspase-3 (red) and ( B ) megalin (red) in control and Stx2/LPS mice given vehicle or C3aRa. Arrowheads indicate loss of megalin expression on the proximal tubular cell brush border. Cell membranes and nuclei were stained with FITC-WGA-lectin (green) and DAPI (blue), respectively. Scale bars: 20 μm. Results are expressed as mean ± SEM ( n = 4 per each group), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: The C3aR blockade reduced proximal tubular cell apoptosis and restored megalin expression in Stx2/LPS mice. ( A , B ) Representative images and quantification of ( A ) cleaved caspase-3 (red) and ( B ) megalin (red) in control and Stx2/LPS mice given vehicle or C3aRa. Arrowheads indicate loss of megalin expression on the proximal tubular cell brush border. Cell membranes and nuclei were stained with FITC-WGA-lectin (green) and DAPI (blue), respectively. Scale bars: 20 μm. Results are expressed as mean ± SEM ( n = 4 per each group), and ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: Cells were incubated with a rabbit anti-C3aR (1:50; LS-C382362, Lifespan BioSciences, Seattle, DC, USA) antibody followed by a Cy3-conjugated secondary antibody (1:80; 711-165-152, Jackson ImmunoResearch Laboratories).

    Techniques: Expressing, Staining

    The C3aR blockade restores mitochondrial morphology and function in proximal tubular cells in Stx2/LPS mice. ( A , B ) Representative transmission electron microscope images and morphometric analysis showing mitochondrial morphology in proximal tubular cells of control and Stx2/LPS mice, given vehicle or C3aRa. Scale bars: 500 nm. Results are expressed as mean ± SEM (control: n = 6768 mitochondria analyzed in n = 3 mice; Stx2/LPS + vehicle: n = 4238 mitochondria analyzed in n = 3 mice; Stx2/LPS + C3aRa: n = 7100 mitochondria analyzed in n = 3 mice). ( C ) Representative images and quantification of tubular VDAC (upper panels) and ATP5I (bottom panels) stainings in control and Stx2/LPS mice with or without C3aRa. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7). ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: The C3aR blockade restores mitochondrial morphology and function in proximal tubular cells in Stx2/LPS mice. ( A , B ) Representative transmission electron microscope images and morphometric analysis showing mitochondrial morphology in proximal tubular cells of control and Stx2/LPS mice, given vehicle or C3aRa. Scale bars: 500 nm. Results are expressed as mean ± SEM (control: n = 6768 mitochondria analyzed in n = 3 mice; Stx2/LPS + vehicle: n = 4238 mitochondria analyzed in n = 3 mice; Stx2/LPS + C3aRa: n = 7100 mitochondria analyzed in n = 3 mice). ( C ) Representative images and quantification of tubular VDAC (upper panels) and ATP5I (bottom panels) stainings in control and Stx2/LPS mice with or without C3aRa. Scale bars: 20 μm. Results are expressed as mean ± SEM (VDAC: control n = 4, Stx2/LPS + vehicle n = 5, Stx2/LPS + C3aRa n = 4; ATP5I: control n = 4, Stx2/LPS + vehicle n = 7, Stx2/LPS + C3aRa n = 7). ANOVA with Tukey multiple-comparisons test was used. * p < 0.05, ** p < 0.01.

    Article Snippet: Cells were incubated with a rabbit anti-C3aR (1:50; LS-C382362, Lifespan BioSciences, Seattle, DC, USA) antibody followed by a Cy3-conjugated secondary antibody (1:80; 711-165-152, Jackson ImmunoResearch Laboratories).

    Techniques: Transmission Assay, Microscopy

    Treatment with the C3aR antagonist limits tubulin alterations in proximal tubules of Stx2/LPS mice. Representative images of tubulin expression (green) in control and Stx2/LPS mice receiving vehicle or C3aRa. Nuclei were stained with DAPI (blue). Scale bars: 20 μm.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Treatment with the C3aR antagonist limits tubulin alterations in proximal tubules of Stx2/LPS mice. Representative images of tubulin expression (green) in control and Stx2/LPS mice receiving vehicle or C3aRa. Nuclei were stained with DAPI (blue). Scale bars: 20 μm.

    Article Snippet: Cells were incubated with a rabbit anti-C3aR (1:50; LS-C382362, Lifespan BioSciences, Seattle, DC, USA) antibody followed by a Cy3-conjugated secondary antibody (1:80; 711-165-152, Jackson ImmunoResearch Laboratories).

    Techniques: Expressing, Staining

    Stx2 increases podocyte and tubular cell sensitivity to C3a through the upregulation of C3aR expression in vitro. ( A ) Representative images and quantification of C3aR staining (red) in podocytes and RPTECs exposed to control medium or Stx2 (50 pM) for 15 h. Nuclei were counterstained with DAPI (blue). Scale bars: 20 μm. Results are presented as mean ± SEM (number of biological samples: n = 3 control and Stx2-treated podocytes; n = 4 control RPTECs and n = 6 Stx2-treated RPTECs), and unpaired Student’s t test was used. ( B ) Representative images of mitochondria labeled with MitoTracker in live podocytes and RPTECs incubated with control medium, C3a (1 μM, 6 h) alone, or with Stx2 (50 pM, 24 h) in the presence of C3a, added in the last 6 h. Nuclei were counterstained with Hoechst (blue). Arrowhead indicates mitochondrial swelling. The percentage of cells with an altered mitochondrial pattern, in terms of fragmentation and perinuclear redistribution, on total cells per field was quantified. Scale bars: 20 μm. Results are expressed as mean ± SEM (number of biological samples: n = 3 control, C3a and Stx2 + C3a-treated podocytes and RPTECs), and ANOVA with Tukey multiple-comparisons test was used. ** p < 0.01.

    Journal: Cells

    Article Title: Shiga Toxin 2 Triggers C3a-Dependent Glomerular and Tubular Injury through Mitochondrial Dysfunction in Hemolytic Uremic Syndrome

    doi: 10.3390/cells11111755

    Figure Lengend Snippet: Stx2 increases podocyte and tubular cell sensitivity to C3a through the upregulation of C3aR expression in vitro. ( A ) Representative images and quantification of C3aR staining (red) in podocytes and RPTECs exposed to control medium or Stx2 (50 pM) for 15 h. Nuclei were counterstained with DAPI (blue). Scale bars: 20 μm. Results are presented as mean ± SEM (number of biological samples: n = 3 control and Stx2-treated podocytes; n = 4 control RPTECs and n = 6 Stx2-treated RPTECs), and unpaired Student’s t test was used. ( B ) Representative images of mitochondria labeled with MitoTracker in live podocytes and RPTECs incubated with control medium, C3a (1 μM, 6 h) alone, or with Stx2 (50 pM, 24 h) in the presence of C3a, added in the last 6 h. Nuclei were counterstained with Hoechst (blue). Arrowhead indicates mitochondrial swelling. The percentage of cells with an altered mitochondrial pattern, in terms of fragmentation and perinuclear redistribution, on total cells per field was quantified. Scale bars: 20 μm. Results are expressed as mean ± SEM (number of biological samples: n = 3 control, C3a and Stx2 + C3a-treated podocytes and RPTECs), and ANOVA with Tukey multiple-comparisons test was used. ** p < 0.01.

    Article Snippet: Cells were incubated with a rabbit anti-C3aR (1:50; LS-C382362, Lifespan BioSciences, Seattle, DC, USA) antibody followed by a Cy3-conjugated secondary antibody (1:80; 711-165-152, Jackson ImmunoResearch Laboratories).

    Techniques: Expressing, In Vitro, Staining, Labeling, Incubation

    Detection of the specificity of the rabbit anti-C3aR pAbs. (A–D) Blocking of the anti-C3aR pAbs by preincubation with the antigenic peptide used for pAb development. (A) Gating strategy for flow cytometry analysis of HKLs stained with rabbit anti-C3aR pAbs. The lymphocytes (Lym) were gated to further analyze the C3aR positive cells. (B) Lym in HKLs stained with rabbit IgG isotype control Abs. (C) Lym in HKLs stained with rabbit anti-C3aR pAbs. (D) Lym in HKLs stained with peptide-preincubated rabbit anti-C3aR pAbs. The rabbit anti-C3aR pAbs were preincubated with the peptide at different molar ratios for 30 min, then stained HKLs for flow cytometry. (E, F) Expression of C3aR in C3aR + Lym and C3aR - Lym. (E) Sorting of C3aR + Lym and C3aR - Lym by FACS. HKLs were stained with rabbit anti-C3aR pAbs, then C3aR + Lym and C3aR - Lym were sorted and subjected to RNA isolation and cDNA synthesis. (F) The mRNA expression level of C3aR in C3aR + Lym and C3aR - Lym. The mRNA expression level of C3aR in C3aR + Lym and C3aR - Lym was analyzed by qPCR and normalized against the expression of β-actin using the 2 −ΔCt method. One representative result was shown in (A–E) . Data in (F) are presented as mean ± SEM (n = 5 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (** p < 0.01).

    Journal: Frontiers in Immunology

    Article Title: Complement C3a Enhances the Phagocytic Activity of B Cells Through C3aR in a Fish

    doi: 10.3389/fimmu.2022.873982

    Figure Lengend Snippet: Detection of the specificity of the rabbit anti-C3aR pAbs. (A–D) Blocking of the anti-C3aR pAbs by preincubation with the antigenic peptide used for pAb development. (A) Gating strategy for flow cytometry analysis of HKLs stained with rabbit anti-C3aR pAbs. The lymphocytes (Lym) were gated to further analyze the C3aR positive cells. (B) Lym in HKLs stained with rabbit IgG isotype control Abs. (C) Lym in HKLs stained with rabbit anti-C3aR pAbs. (D) Lym in HKLs stained with peptide-preincubated rabbit anti-C3aR pAbs. The rabbit anti-C3aR pAbs were preincubated with the peptide at different molar ratios for 30 min, then stained HKLs for flow cytometry. (E, F) Expression of C3aR in C3aR + Lym and C3aR - Lym. (E) Sorting of C3aR + Lym and C3aR - Lym by FACS. HKLs were stained with rabbit anti-C3aR pAbs, then C3aR + Lym and C3aR - Lym were sorted and subjected to RNA isolation and cDNA synthesis. (F) The mRNA expression level of C3aR in C3aR + Lym and C3aR - Lym. The mRNA expression level of C3aR in C3aR + Lym and C3aR - Lym was analyzed by qPCR and normalized against the expression of β-actin using the 2 −ΔCt method. One representative result was shown in (A–E) . Data in (F) are presented as mean ± SEM (n = 5 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (** p < 0.01).

    Article Snippet: The rabbit anti-grass carp C3aR pAbs were raised and purified by AtaGenix Ltd. as above described using an antigenic peptide at the N-terminal of grass carp C3aR (NESHYNDDMNSSGYDC) (GenBank accession number: MG599686.1).

    Techniques: Blocking Assay, Flow Cytometry, Staining, Control, Expressing, Isolation, cDNA Synthesis

    C3aR is highly expressed by grass carp IgM + B cells. (A) Immunofluorescence microscopy of C3aR on IgM + B cells. HKLs were first co-stained with mouse anti-grass carp IgM mAbs and rabbit anti-grass carp C3aR pAbs, then co-stained with Alex Flour 488-conjugated goat anti-mouse IgG (green for IgM) and Cy5-conjugated goat anti-rabbit IgG (magenta for C3aR). The mouse IgG isotype Abs and rabbit IgG isotype Abs were used as the negative controls. Nuclei were stained with DAPI (blue). One representative result was shown in the immunofluorescence images. Scale bars, 2 μm. (B) The mRNA expression pattern of C3aR in IgM + B cells, IgM - lymphocytes (Lym), subset I myeloid cells (Mye I), and subset II myeloid cells (Mye II). HKLs were stained with mouse anti-grass carp IgM mAbs, then cell populations including IgM + B cells, IgM - Lym, Mye I, and Mye II were sorted and subjected to RNA isolation and cDNA synthesis. The mRNA expression level of C3aR in the cell populations was analyzed by qPCR and normalized against the expression of β-actin using the 2 −ΔCt method. One representative result was shown in the dot plot of flow cytometry. Data are presented as mean ± SEM (n = 4 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (ns, not significant; ** p < 0.01).

    Journal: Frontiers in Immunology

    Article Title: Complement C3a Enhances the Phagocytic Activity of B Cells Through C3aR in a Fish

    doi: 10.3389/fimmu.2022.873982

    Figure Lengend Snippet: C3aR is highly expressed by grass carp IgM + B cells. (A) Immunofluorescence microscopy of C3aR on IgM + B cells. HKLs were first co-stained with mouse anti-grass carp IgM mAbs and rabbit anti-grass carp C3aR pAbs, then co-stained with Alex Flour 488-conjugated goat anti-mouse IgG (green for IgM) and Cy5-conjugated goat anti-rabbit IgG (magenta for C3aR). The mouse IgG isotype Abs and rabbit IgG isotype Abs were used as the negative controls. Nuclei were stained with DAPI (blue). One representative result was shown in the immunofluorescence images. Scale bars, 2 μm. (B) The mRNA expression pattern of C3aR in IgM + B cells, IgM - lymphocytes (Lym), subset I myeloid cells (Mye I), and subset II myeloid cells (Mye II). HKLs were stained with mouse anti-grass carp IgM mAbs, then cell populations including IgM + B cells, IgM - Lym, Mye I, and Mye II were sorted and subjected to RNA isolation and cDNA synthesis. The mRNA expression level of C3aR in the cell populations was analyzed by qPCR and normalized against the expression of β-actin using the 2 −ΔCt method. One representative result was shown in the dot plot of flow cytometry. Data are presented as mean ± SEM (n = 4 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (ns, not significant; ** p < 0.01).

    Article Snippet: The rabbit anti-grass carp C3aR pAbs were raised and purified by AtaGenix Ltd. as above described using an antigenic peptide at the N-terminal of grass carp C3aR (NESHYNDDMNSSGYDC) (GenBank accession number: MG599686.1).

    Techniques: Immunofluorescence, Microscopy, Staining, Expressing, Isolation, cDNA Synthesis, Flow Cytometry

    Anti-C3aR pAbs inhibits the phagocytosis-stimulating activity of C3a.1 to grass carp IgM + B cells. (A) Anti-C3aR pAbs inhibits the phagocytosis-stimulating activity of GST-C3a.1 to grass carp IgM + B cells. (B) Anti-C3aR pAbs inhibits the phagocytosis-stimulating activity of C3a.1-CP to grass carp IgM + B cells. HKLs were incubated with GST-C3a.1 or C3a.1-CP, anti-C3aR pAbs or isotype control Abs, as well as fluorescent beads at 28°C for 2 h. Thereafter, the non-ingested beads in cell suspensions were removed, and the cells were stained with mouse anti-grass carp IgM mAbs. Finally, the phagocytic activity of grass carp IgM + B cells was detected using flow cytometry. One representative result was shown in the dot plot of flow cytometry. Data are presented as mean ± SEM (n = 3 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (** p < 0.01).

    Journal: Frontiers in Immunology

    Article Title: Complement C3a Enhances the Phagocytic Activity of B Cells Through C3aR in a Fish

    doi: 10.3389/fimmu.2022.873982

    Figure Lengend Snippet: Anti-C3aR pAbs inhibits the phagocytosis-stimulating activity of C3a.1 to grass carp IgM + B cells. (A) Anti-C3aR pAbs inhibits the phagocytosis-stimulating activity of GST-C3a.1 to grass carp IgM + B cells. (B) Anti-C3aR pAbs inhibits the phagocytosis-stimulating activity of C3a.1-CP to grass carp IgM + B cells. HKLs were incubated with GST-C3a.1 or C3a.1-CP, anti-C3aR pAbs or isotype control Abs, as well as fluorescent beads at 28°C for 2 h. Thereafter, the non-ingested beads in cell suspensions were removed, and the cells were stained with mouse anti-grass carp IgM mAbs. Finally, the phagocytic activity of grass carp IgM + B cells was detected using flow cytometry. One representative result was shown in the dot plot of flow cytometry. Data are presented as mean ± SEM (n = 3 fish), and the statistic p value was calculated by one-way ANOVA with a Dunnett post hoc test (** p < 0.01).

    Article Snippet: The rabbit anti-grass carp C3aR pAbs were raised and purified by AtaGenix Ltd. as above described using an antigenic peptide at the N-terminal of grass carp C3aR (NESHYNDDMNSSGYDC) (GenBank accession number: MG599686.1).

    Techniques: Activity Assay, Incubation, Control, Staining, Flow Cytometry